Chinese Medical Journal 2003;116(4):543-548
IL-17 induces autoantibody overproduction and peripheral blood mononuclear cell overexpression of IL-6 in lupus nephritis patients

DONG Guangfu 董光富,  YE Rengao 叶任高,  SHI Wei 史 伟,  LIU Shuangxin 刘双信,  WANG Tao 汪 涛,  YANG Xiao 阳 晓,  YANG Niansheng 杨念生

DONG Guangfu 董光富 (Department of Nephrology and Rheumatology, Guangdong Provincial People’s Hospital, Guangzhou 510080, China)

YE Rengao 叶任高 (Department of Nephrology, Key Clinical Kidney Research Institute of Ministry of Health, First Affiliated Hospital, Sun Yat-sen University of Medical Sciences, Guangzhou 510080, China)

SHI Wei 史 伟 (Department of Nephrology and Rheumatology, Guangdong Provincial People’s Hospital, Guangzhou 510080, China)

LIU Shuangxin 刘双信 (Department of Nephrology and Rheumatology, Guangdong Provincial People’s Hospital, Guangzhou 510080, China)

WANG Tao 汪 涛 (Department of Nephrology, Key Clinical Kidney Research Institute of Ministry of Health, First Affiliated Hospital, Sun Yat-sen University of Medical Sciences, Guangzhou 510080, China)

YANG Xiao 阳 晓 (Department of Nephrology, Key Clinical Kidney Research Institute of Ministry of Health, First Affiliated Hospital, Sun Yat-sen University of Medical Sciences, Guangzhou 510080, China)

YANG Niansheng 杨念生 (Department of Nephrology, Key Clinical Kidney Research Institute of Ministry of Health, First Affiliated Hospital, Sun Yat-sen University of Medical Sciences, Guangzhou 510080, China)

Correspondence to:DONG Guangfu,Department of Rheumatology, Guangdong Provincial People’s hospital, Guangzhou 510080, China (Tel: 86-20-83827812-2201/2132. Fax:. E-mail:Dongguangfu@.263.net)
Keywords
lupus nephritis;peripheral blood mononuclear cells;IL-17;IL-6;IgG;anti-dsDNA
Abstract
Objective To investigate the role of IL-17 in the overproduction of autoantibodies and IL-6 overexpression by peripheral blood mononuclear cells (PBMC) of lupus nephritis (LN) patients.
Methods Fifteen consecutively hospitalized LN patients were selected as subjects and 15 healthy adults as normal controls. PBMC were obtained by Ficoll density gradient centrifugation. IgG, anti-dsDNA antibody and IL-6 protein levels were assessed using enzyme-linked immunosorbent assays (ELISA) on the supernatant of cultured PBMC of LN patients or normal controls. IL-6 mRNA levels in PBMC were measured using reverse transcription-polymerase chain reaction (RT-PCR).
Results In medium culture, IgG, anti-dsDNA and IL-6 protein levels of the supernatant of PBMC from LN patients were significantly higher than those from normal controls (1492.1±73.2 ng/ml vs 636.7±51.9 ng/ml for IgG, 306.6±53.7 IU/ml vs 95.8±11.6 IU/ml for anti-dsDNA and 50.92±15.92 ng/ml vs 1.77±0.73 ng/ml for IL-6, all P<0.001). In LN patients, IgG, anti-dsDNA and IL-6 protein levels were higher in the supernatants of PBMC in the IL-17-stimulated culture than the medium culture, but in normal controls, only the IL-6 protein levels were significantly higher. The increase in IgG, anti-dsDNA and IL-6 protein levels induced by IL-17 was dose-dependent and could be completely blocked by IL-17 monoclonal antibody mIgG28 and partially blocked by dexamethasone. Similarly, IL-6 mRNA overexpression of PBMC in LN patients or normal controls induced by IL-17 was both dose- and time-dependent. During medium culture, IL-6 mRNA levels in LN patients were significantly higher than those in normal controls (1.80±0.11 vs 0.36±0.07). During stimulation with IL-17, IL-6 mRNA levels in LN patients were higher than those in normal controls (3.21±0.24 vs 1.30±0.14, P<0.05) and also significantly higher when comparing the stimulated culture with the medium culture either in LN patients or normal control.
Conclusions IL-17 may play an important role in the pathogenesis of LN through the induction of IgG, anti-dsDNA overproduction and IL-6 overexpression of PBMC in LN patients.
Interleukin-17 (IL-17) is a newly-discovered cytokine associated with inflammation and autoimmune diseases and is derived from activated CD4+ T cells. The cytokine is composed of covalently-bound homodimers with a molecular weight of 32 kDa. Mouse, rat and human genomes contain a single copy of the IL-17 gene; its expression is tightly regulated. Some biological activities of IL-17 were clarified recently.[1,2] In a previous study, we found that there was increased expression of IL-17 in peripheral blood mononuclear cells (PBMC) and renal tissue, and that IL-17 in urine was increased in lupus nephritis (LN) patients.[3,4] However, it is still unclear whether IL-17 participates in the pathogenesis of LN. At present, pathogenesis of LN has not been elucidated clearly, but it is well-known that autoantibodies such as anti-ds DNA, as well as some cytokines, including interleukin-6 (IL-6) and interleukin-10 (IL-10), play significant roles.[5,6] In this study, we cultured PBMC of LN patients and normal controls in vitro with and without rhIL-17, then measured their IL-6 expression and IgG and anti-dsDNA antibody levels. Our purpose is to investigate the role of IL-17 in the initiation and progress of LN.

METHODS

Study subjects
Fifteen consecutively hospitalized LN patients were admitted to our study from August 1999 to March 2000 in accordance with systemic lupus erythematosus (SLE) criteria of Association of Rheumatology of America (ARA) in 1982 such that they had clinical evidence of nephritis, which requires either the presence of proteinuria (≥0.5 g/24 hours) or an active urine sediment (>8 to 10 erythrocytes or their casts per high power field;). Renal biopsy was performed in all patients. The SLE disease activity index (SLEDAI) of each patient was measured using Bombardier’ method.[7] Of the 15 LN patients, all were active. Nine were female with a mean age of 28.2±10.3 years old (ranging from 14-42 years) and a mean disease course of 2.8±0.5 years (20 d-5 years). Eleven of the 15 cases first sought medical attention but were not given glucocorticoid hormone and immunoinhibitors therapy, while the other 4 cases relapsed and stopped glucocorticoid hormone and other immunoinhibitors at least 48 hours before blood sampling. The fifteen healthy adults were selected during hospital visits for regular physical examinations. Ten of the 15 cases were female and did not significantly differ from LN patients in age or sex.

Separation and culture of PBMC
10 ml of venous blood from LN patients and control subjects were collected, anti-agglutinated with heparin Na, and diluted with an equal volume of cold phosphate buffer solution (PBS). PBMCs were separated with Lymphocyte Separation Medium (Peking Tian Xiang Ren, China) by Ficoll density gradient centrifugation, then counted using 0.2% trypan blue; live cells needed to comprise over 95% of the cell population. 2×106/ml PBMC suspensions were prepared with RPMI containing 10% newly-born calf serum and were incubated for 24 hours in 24-well culture dishes in 5% CO2 at 37℃ to be used for further testing.

Experimental protocols
To ascertain the possible dose-dependent effects of IL-17 on IgG, anti-dsDNA antibody and IL-6 protein secreted by PBMC in active LN patients, different end concentrations of rhIL-17 (R&D Systems, Great Britain) at 0 ng/ml, 1 ng/ml, 10 ng/ml, 20 ng/ml, 50 ng/ml and 100 ng/ml were added to medium. PBMC were incubated continually for 24 hours, after which, their supernatants were collected and kept at -20℃ for enzyme-linked immunosorbent assays (ELISA) analysis.

In order to determine any dose-dependent effects of IL-17 on IL-6 mRNA expression in PBMC in active LN patients, different end concentrations of IL-17 (0 ng/ml, 1 ng/ml, 10 ng/ml, 50 ng/ml and 100 ng/ml) were added to medium. PBMC were incubated continually for 4 hours and collected for extraction of total RNA, which was used for analysis of IL-6 mRNA expression by reverse transcription-polymerase chain reaction (RT-PCR).

To identify the possible effects of IL-17 monoclonal antibody-mIgG28 (R&D Systems, Great Britain) or dexamethasone (Dex) (Sigma Co., USA) on the above PBMC responses to IL-17, 10 μg/ml mIgG28 or 50 ng/ml Dex was added to medium 30 min before the introduction of 50 ng/ml IL-17. PBMC were incubated for 4 hours and collected for abstraction of total RNA and analysis of IL-6 mRNA expression. PBMC were incubated for 24 hours, at which point their supernatants were collected for measurement of IgG, anti-dsDNA and IL-6 protein level via ELISA. For the purpose of determining possible time-dependent effects of IL-17 on IL-6 mRNA expression of PBMC in active LN patients, 50 ng/ml IL-17 were added to PBMC containing medium and then incubated for different time periods (0 min, 15 min, 30 min, 1 h, 2 h, 4 h, 8 h and 16 h), then collected for abstraction of total RNA and analysis of IL-6 mRNA levels.

The incubation times and doses of IL-17 and doses of mIgG28 for blockage were performed as reported in previous report and preliminary experiments. For the sake of assessing different effects of IL-17 on PBMC IL-6 mRNA expression between active LN patients and control subjects, their respective PBMC were divided into the following groups and cultured: ① medium culture; ② conditioned culture (50 ng/ml IL-17). PBMC were collected at times indicated and their IL-6 mRNA levels were analyzed.

Detection of IgG, anti-dsDNA and IL-6 protein
IgG, anti-dsDNA and IL-6 protein levels were detected using IgG and anti-dsDNA detection kit (Dioclon Co.), while IL-6 was evaluated by a kit (France International Immunological Reagent Co.). Experiments were performed according to manufacturer’s instruction.

Semi-quantitative RT-PCR detection of IL-6 mRNA
Total RNA of PBMC was extracted with Trizol reagent (Gibco BRL, USA) and then used to synthesize cDNA with an RT Kit (Gibco BRL, USA).The primer sequences were as follows: IL-6(639bp) forward: 5’ATGAACTC CTTCTCCACAAGC3’, and reverse: 5’CTACATTTGCCGAAGAGCCCTCAGGCTGGACTG3’; β-actin (200 bp) forward: 5’AGCCATGTACGTAGCCATCC3’, and reverse: 5’GTCCATGCAGTTCTTGGTCA3’.Prepared cDNA was used for PCR amplification with the above primers under the following conditions: 94℃ for 2 min, 94℃ for 45 sec, 55℃ for 45 sec, 72℃ for 30 sec for 30 cycles, then 72℃ for 10 minutes.

PCR products were analyzed by electrophoresis on a 1.5% agarose gel containing 0.5 μg/ml ethidium bromide. The resulting bands were observed and photographed under ultraviolet light and were measured as A values by the Digital Gel Imaging Analyst (Nikon 990-Doc 1000, USA). The relative values of IL-6 mRNA were calculated using β-actin mRNA as a standard.

Statistical analysis
All data were expressed as ±s. The t-test was used to compare differences in means between two groups. ANOVA and q test were used for comparison of more than two groups. All data were analyzed with SPSS 8.0 for Windows. Significance was set at α=0.05.

RESULTS

IL-17 induced overproduction of IgG and anti-dsDNA from PBMC in LN patients
In Figs. 1 and 2 , IgG and anti-dsDNA levels in the supernatant of PBMC in the LN group were significantly higher than that in the control group (IgG: 1492.1±73.2 vs 636.7±51.9; anti-dsDNA: 306.6±53.7 vs 95.0±11.0; both P<0.005) under medium culture. In IL-17-stimulated culture, IgG and anti-dsDNA levels significantly increased dependent on IL-17 dose from 1 ng/ml to 50 ng/ml in the LN group, but not in the control group. Moreover, this dose-dependent response could be completely blocked by rhIL-17 monoclonal antibody-mIgG28 or partially inhibited by Dex. At each IL-17 dose point, IgG and anti-dsDNA antibody level was markedly higher in the LN group than in the control group (P<0.01). In addition, there were a significant difference in IgG and anti-dsDNA levels between the stimulated-culture and medium culture in LN patients (P<0.05) but not in control subjects (P>0.05).

IL-17 enhanced IL-6 protein synthesis in PBMC
Fig. 3 shows that IL-6 protein levels greatly increased dependently with IL-17 end concentrations from 1 ng/ml-50 ng/ml in both LN and control groups in IL-17-stimulated cultures, a response which could be completely blocked by mIgG28 or partially inhibited by Dex. For the same IL-17 end concentration points, IL-6 protein levels are much higher in the LN group than in the control group (P<0.005).

IL-17 enhanced IL-6 mRNA expression in PBMC
Fig. 4 shows that IL-6 mRNA expression levels arose markedly with IL-17 in a dose-dependent fashion in the range of 1 ng/ml - 50 ng/ml in IL-17-stimulated cultures in the LN group, a response that could be completely blocked by mIgG28 or partially inhibited by Dex. In Fig. 5 , a significant time-dependent effect is demonstrated between elevated IL-6 mRNA expression and duration of stimulation at the range of 0-4 h.

In Fig. 6 , IL-6 mRNA expression was much higher in the LN group than in the control group in both medium culture (1.80±0.11 vs 0.36±0.07, P<0.001) and stimulated culture (3.21±0.24 vs1.30±0.14, P<0.005) at an IL-17 end concentration of 50 ng/ml. In addition, there was a significantly increased IL-6 mRNA level when comparing the stimulated culture with the medium culture in the LN group or the control group (P<0.05).

DISCUSSION

Currently, it is thought that T cell and B cell hyperactivity leading to pathogenic autoantibodies overproduction is a key link in the pathogenesis of LN. In recent years, a number of studies have shown that cytokines might play an important role in the pathogenesis of LN. They may participate in the initiation and development of LN through a number of different mechanisms such as representing as a costimulator, induction of T or B cell hyperactivity and overproliferation, induction of T cells or B cells autoreactivity to autoantigen and secretion of autoantibodies and promotion of overexpression and overproduction of other cytokines, adhesion molecules and chemotactic factors.[5,8] In its normal physiological state, IL-17 as a Th1-type cytokine has no effects on proliferation, phenotype, cytokine expression, immunoglobulin and autoantibodies production of PBMC, purified CD4+ T cells or CD8+ T cells whether or not phytohemagglutinin (PHA) or IL-2 pre-stimulation is present.[9] With regard to the LN patients, a study on whether IL-17 can stimulate PBMC to activate, proliferate and secrete autoantibodies and cytokines has not yet been published.

Our study showed that there was no elevation of IgG or anti-dsDNA in controls, which agrees with results from Fossiez et al,[10] but that they did significantly increase in LN patients in both types of experimented cultures. Furthermore, IL-17 could significantly induce synthesis and secretion of IgG and anti-dsDNA by PBMC in LN patients in a dose-dependent manner, which could be completely blocked by IL-17 monoclonal antibody (mIgG28) and markedly inhibited by a nonspecific inhibitor of inflammation and immunity. The following reasons were suggested. In one aspect, the PBMC of LN patients could have been overactivated by some unknown factors in vivo resulting in T or B cell hyperactivity, proliferation and autoreactivity to autoantigen, leading to further overproduction of autoantibodies. Another possibility is that IL-17 can promote PBMC of LN patients to produce immunoglobulins and autoantibodies. In addition, greater responses of PBMC to IL-17 in LN patients may be due to pre-stimulation of PBMC before culture, such that they were more sensitive to IL-17 stimulation. These results indicated that IL-17 might take part in initiation and progress of LN by induction of autoantibody overproduction.

IL-6 is a well-known and important cytokine of LN pathogenesis in the study. One of its main biological functions is to regulate proliferation and classification of B cells and directly affect immunoglobulin secretion of mature B cells. While observing the effects of IL-17 on the IL-6 expression and secretion of PBMC, we found that PBMC of LN patients were more prone to IL-6 autosecretion than the PBMC of normal controls and produced even more IL-6 when IL-17 was introduced in a dose-dependent fashion. We also found that this effect of IL-17 was abolished by mIgG28 and markedly inhibited by Dex, indicating that PBMC of LN patients had been somewhat active, significantly increasing IL-6 synthesis and secretion over PBMC of controls. The overproduction of IL-6 in the IL-17-stimulated culture was really due to IL-17-specific stimulation. Furthermore, there was a significantly higher IL-6 mRNA level in LN patients than in controls in both types of culture. At the same time, there was a significant difference in IL-6 mRNA levels between the medium culture and the IL-17-stimulated culture. From the above results, the following can be inferred: first, IL-6 mRNA overexpression corresponded with IL-6 overproduction in LN patients. This agrees with results reported by Lixia Z, et al.[6,11,12] Secondly, IL-17 induction of significantly higher IL-6 mRNA expression corresponds with IL-17 induction of markedly higher IL-6 protein levels. All results suggested that IL-17 can also play an important role in the pathogenesis of LN through specifically enhancing overexpression and overproduction of IL-6 in PBMC.

In these experiments, we also found that IL-17 can simultaneously enhance PBMC of LN patients and normal controls to synthesize and secrete IL-6, but it cannot induce PBMC of normal controls to augment IgG and anti-dsDNA secretion. This suggested that the IL-17 effect on induction of increased IgG or anti-dsDNA level by PBMC may be special or dependent on characteristics of immunological and genetic abnormalities occurring in PBMC of LN patients. In addition, it was already known that IL-6 could stimulate PBMC of LN patients in vitro to enhance synthesis and secretion of autoantibodies.[13] Moreover, very few studies showed that some IL-17 biological functions may be secondary to its induction of IL-6 overproduction by PBMC at the beginning.[14] Therefore, further study is required to ascertain whether IL-17 induces the increased synthesis and secretion of autoantibodies through enhancement of IL-6 overexpression by PBMC in LN patients.

Generally, IL-17 may play an important role in the initiation and development of LN through induction of IL-6 overexpression and autoantibody overproduction in PBMC. With regards to the IL-17 signal pathway related to induction of autoantibody overproduction and IL-6 overexpression, further investigation is necessary.

Acknowledgments: Many thanks to Dr. Huang Yijun and MD. Liu Wenming for their support and help in PCR and image analysis, and Kong Qinyu technician for his help in ELISA.

REFERENCES

1. Yao Z, Panter SL, Fanslow WC, et al. Human IL-17: a novel cytokine derived from T cells. J Immunol 1995;155:5483-5486.
2. Fossiez F, Bancherreau J, Murray R, et al. Iterleukin-17. Intern Rev Immunol 1998;16:541-551.
3.Dong GF, Ye RG, Chen XH, et al. Preliminary investigation on the relationship of IL-17 expression and lupus nephritis. Chin JRheumatol 2001;5:152-155.
4.Dong GF, Ye RG, Li YJ, et al. Preliminary observation of IL-17 expression by peripheral blood mononuclear cells in systemic lupus erythematosus. Chin J Microbiol Immunol 2001;21:435-436.
5.Foster MH, Kelly VB. Lupus Nephritis: update on pathogenesis and disease mechanisms. Sem Nephrol 1999;19:173-181.
6.Zeng LX, Ye RG, Sun L, et al. Observation of overexpression of IL-6 by peripheral blood mononuclear cell in lupus nephritis. Chin J Microbiol Immunol 1997;17:442-444.
7. Bombardier C, Gladman DD, Urowiz MB, et al. Derivation of the SLEDAI: a disease activity index for lupus patients. Arthritis Rheum 1992;35:630-640.
8. Kelly VR, Wuthrich RP. Cytokines in the pathogenesis of systemic lupus erythematosus. Semi Nephrol 1999;19:57-66.
9. Aarvak T, Chabaud M, Miossec P, et al. IL-17 is produced by some proinflammatory Th1/Th0 cells but not by Th2 cells. J Immunol 1999;162:1246-1251.
10. Fossiez F, Djossou O, chomarat P, et al. T-cell IL-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med 1996;183:2593-2603.
11. Linker-Isvaeli M, Deans RJ, Wallace DJ, et al. Elevated levels of endogenous IL-6 in systemic lupus erythematosus: a putative role in pathogenesis. J Immunol 1991;147:117-121.
12. Kitani A, Hara M, Hirose T, et al. Autostimulatory effects of IL-6 on expressive B cell differentiation in patients with systemic lupus erythematosus: analysis of IL-6 production and IL-6R expression. Clin Exp Immunol 1992;88:75-80.
13.Appel GB, Radhakrishnan J, D’Agati V. Secondary glomerular disease. In: Brenner BM and Rector FC Jr(eds): The Kidney. 6th ed. Philadelphia: W. B. Saunders; 2001:1353-1364.
14. Krause A, Holtmann H, Eickemeier S, et al. Stress-activated protein kinase/Jun N-terminal kinase is required for interleukin(IL)-17 induced IL-6 and IL-8 gene expression in the human epidermal carcinoma cell line KB. J Biol Chem 1998;273:23681-23689.

  1. 211 key projects of Sun Yat-Sen University of Medical Sciences,No. 981517;