Home About us Articles Multimedia Search Instructions Login 
IF 2017: 1.596 (® Clarivate Analytics)
Total Cites: 7606
Q2 in Medicine, General & Internal
Follow Us
Follow Us
  • Users Online: 1014
  • Home
  • Print this page
  • Email this page

 Table of Contents  
CORRESPONDENCE
Year : 2018  |  Volume : 131  |  Issue : 23  |  Page : 2882-2885

Calcium Receptor and Nitric Oxide Synthase Expression in Circular Muscle of Lower Esophagus from Patients with Achalasia


1 Department of Thoracic Surgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011; Graduate School, Hebei Medical University, Shijiazhuang, Hebei 050017, China
2 Department of Thoracic Surgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, China
3 Graduate School, Hebei Medical University, Shijiazhuang, Hebei 050017, China
4 Department of Pathology, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, China
5 Research Center, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011, China

Date of Submission30-May-2018
Date of Web Publication23-Nov-2018

Correspondence Address:
Prof. Jun-Feng Liu
Department of Thoracic Surgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, Hebei 050011
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0366-6999.246081

Rights and Permissions

How to cite this article:
Gao Y, Liu JF, He X, Liu XB, Zhang LL, Zhao LM, Zhang C. Calcium Receptor and Nitric Oxide Synthase Expression in Circular Muscle of Lower Esophagus from Patients with Achalasia. Chin Med J 2018;131:2882-5

How to cite this URL:
Gao Y, Liu JF, He X, Liu XB, Zhang LL, Zhao LM, Zhang C. Calcium Receptor and Nitric Oxide Synthase Expression in Circular Muscle of Lower Esophagus from Patients with Achalasia. Chin Med J [serial online] 2018 [cited 2018 Dec 9];131:2882-5. Available from: http://www.cmj.org/text.asp?2018/131/23/2882/246081



To the Editor: Achalasia is a primary esophageal motility disorder.[1] The etiology of achalasia remains unknown, but it is associated with degeneration, reduction, or absence of neurons in the esophageal muscular layer (Auerbach's plexus), leading to nerve–muscle conduction abnormalities.[2] It has been demonstrated that excitatory neurons induce calcium ion (Ca2+) activity and contract smooth muscles by releasing acetylcholine[3] in esophagus, and nitric oxide (NO) and vasoactive intestinal peptide (VIP) induce smooth muscle relaxation by inhibitory neurons.[4] Hydrogen sulfide synthases may also be involved.[5] We measured expression of L-type calcium channels (LTCCs),[6] ryanodine receptors (RyRs),[7] inositol 1, 4, 5-trisphosphate receptors (IP3 Rs),[7] and NO synthases (NOSs)[4],[8] in circular muscles of the lower esophagus of achalasia patients. The result provides a better understanding for the pathogenesis of achalasia.

Circular muscles from the lower esophagus were obtained from achalasia patients undergoing Heller's myotomy (the experimental group) and esophageal cancer patients undergoing esophagectomy for the upper esophageal carcinoma (the control group) between January 2015 and October 2017. Achalasia patients underwent preoperative esophageal manometry routinely. Specimens were removed during surgery as previous procedures.[3] Tissues for immunohistochemistry (IHC) were immersed in 10% neutral formalin immediately and for RNA-related experiments were immersed in RNAlater (Thermo Scientific, USA) and stored at −80°C. Hematoxylin and eosin staining was conventional in controls to ensure that there was no invasion of tumor cells.

RNA was obtained according to the protocol of TriQuick total RNA extraction kit (R1100, Solarbio, China). Each real-time PCR reaction included 2 μl reverse transcription product, 5 μl SYBR Green qPCR SuperMix (2×) (11744100, Invitrogen, USA), 0.8 μl mixture of forward and reverse primers in 100-fold dilution, and 2.2 μl nuclease-free water. Reactions were carried out in ABI 7500 Real-Time PCR System (Thermo Scientific, USA) for 40 cycles (95°C for 30 s, the annealing temperature for 30–40 s, and 72°C for 30–40 s). Primer information is as follows (5′-3′): Cav1.2-(F) ATCACCGAGGTAAACCCAGC, (R) CCGATCACCGCGTAGATGAA, annealing temperature (AT) 59°C, product (bp) 236; Cav1.3-(F) TGCGATAGGATGGGAATGGC, (R) TCCACCAGCACCAGAGACTT, AT 61°C, product (bp) 365; Cav1.1-(F) GACTGTATTGCCTGGGTGGAG, (R) TGCCGATGACAGCGTAGATG, AT 59°C, product (bp) 225; IP3R1-(F) TAACCCAGGCTGCAATGAGG, (R) CACTGAGGGCTGAAACTCCA, AT 61°C, product (bp) 394; IP3R2-(F) TTATGTGCACAGGACCAGAAGC, (R) ATGATGGCAATTGCGGGACT, AT 58°C, product (bp) 82; IP3R3-(F) GCGTCCCGAGATGACAAGAA(R) CCAGGCTGACCACCTCAAAA, AT 58°C, product (bp) 139; RyR1GGGAGAACGGTGAAGCTGAA, (R) CTGGCGATTGATGACAGTGC, AT 59°C, product (bp) 389; RyR2-(F) TGAAAGCATCAAACGCAGCA, (R) TCCACCACACAGCCAATCTC, AT 59°C, product (bp) 105; RyR3-(F) AGGAGCAGTTGAAAGCCGAT, (R) CCAGACTTTACTTGCATGGC, AT 59°C, product (bp) 334; iNOS-(F) GAGCTTCTACCTCAAGCTATC, (R) CCTGATGTTGCCATTGTTGGT, AT 58°C, product (bp) 312; nNOS-(F) CCCTTCAGTGGCTGGTACAT, (R) ACCGCGATATTGATCTCCAC, AT 58°C, product (bp) 164; eNOS-(F) ACTGAAGGCTGGCATCTGGAA, (R) ACCTCCCAGTTCTTCACACGA, AT 58°C, product (bp) 329; GAPDH-(F) CGCTGAGTACGTCGTGGAGTC, (R) GCTGATGATCTTGAGGCTGTTGTC, product (bp) 172. The fold-change in the expression of each gene was calculated using the 2−ΔCt method with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. mRNA expression of these proteins in the achalasia group was analyzed by linear correlation with integrated relaxation pressure (IRP) of esophageal manometry. Reverse transcription polymerase chain reaction (RT-PCR) for each sample was detected by DreamTaq Green PCR Master Mix (2×) (K1081, Thermo Scientific, USA) in the AB Applied Biosystems-Veriti 96-well Thermal Cycler (Thermo Scientific, USA), with the same amplification procedure as real-time RT-PCR. Base sequences of the products were detected by Invitrogen Company (Thermo Fisher Ltd., Beijing) to determine the corresponding mRNA expression.

IHC and scoring were conducted as described.[9] Primary antibodies of inducible NOS (iNOS) (mouse, Abcam, ab129372), neuronal NOS (nNOS) (rabbit, Abcam, ab3511), Cav1.2 (mouse, Abcam, ab84814), Cav1.3 (mouse, Abcam, ab85491), IP3R1 (rabbit, Abcam, ab125076), IP3R2 (rabbit, Millipore, ab9074), IP3R3 (rabbit, Millipore, ab9076), and RyR2 (rabbit, Chemicon, ab9080) were diluted at 1:100. Three pathologists, blinded to patients' details, measured the extent of expression. Expression was scored as follows: 9–12 = strong, 5–8 = moderate, 1–4 = weak, and 0 = negative. To identify the components of smooth muscles effectively, four specific indicators were selected to assist the identification. The vascular endothelial cells were identified by CD31 (mouse, Zsbio, ZM-0044, 1:100); the hematopoietic cells (lymphocytes and leukocytes, etc.) were identified by CD45 (mouse, Zsbio, ZM-0183, 1:100); the lymphatic vessels were identified by D2-40 (mouse, DAKO, IS07230-2, ready to use); and the nervous tissues were identified by S-100 (mouse, Servicebio, GB13361, 1:200).

Statistical analysis was conducted with SPSS version 13.0 (IBM Corp., USA). Measurement data for real-time RT-PCR that was neither normal nor homogeneous was recorded as (median [interquartile range]), followed by a non-parametric test (Kruskal-Wallis Test). Count data in IHC experiments, in which there were fewer than 40 cases, were evaluated using an exact probability method (Fisher's exact test). For the achalasia group in linear correlation analysis, IRP and mRNA were analyzed using the Spearman's correlation coefficient. Differences were considered statistically significant when P < 0.05.

Ten patients (seven females, aged 48.0 ± 3.5 years, age range: 23–62 years) undergoing Heller's myotomy for achalasia and 17 patients in controls were included. In achalasia patients, the preoperative IRP was 23.05 (16.83) mmHg (range 13.00–96.10 mmHg). According to the Chicago Classification, one patient was Type I, eight were Type II, and one was Type III. The duration of symptoms was 36 (110.6) months (range 1–180 months).

From automatic plotting of dissolution and amplification curves in ABI 7500 and base sequence results of Invitrogen, Cav1.2, Cav1.3, three subtypes of IP3 Rs, RyR2, iNOS, and nNOS were positive in the achalasia and control groups (esophageal circular muscle, EC), but other subtypes were negative [Figure 1]a. Compared with controls, relative mRNA expression of iNOS (0.039 [0.145] vs. 0.000 [0.000], P = 0.000), nNOS (0.001 [0.040] vs. 0.000 [0.001], P = 0.000), Cav1.3 (0.001 [0.087] vs. 0.000 [0.000], P = 0.000), IP3R1 (0.007 [0.029] vs. 0.013 [0.017], P = 0.022), and IP3R2 (0.041 [0.055] vs. 0.012 [0.012], P = 0.000) was greater in the achalasia group (P < 0.05), but with no statistical differences for Cav1.2 (0.003 [0.008] vs. 0.002 [0.003], P = 0.318), RyR2 (0.021 [0.020] vs. 0.017 [0.018], P = 0.119), and IP3R3 (0.001 [0.001] vs. 0.001 [0.002], P = 0.675) between the two groups [Figure 1]b.
Figure 1: Research results of calcium receptors and nitric oxide synthases in achalasia patients. (a) Relative mRNA expression of calcium receptors and nitric oxide synthases. In achalasia and control groups, Cav1.2, Cav1.3, IP3R1, IP3R2, IP3R3, RyR2, inducible nitric oxide synthase, and neuronal nitric oxide synthase could be detected, but Cav1.1, RyR1, RyR3, and epidermal nitric oxide synthase were negative. (b) Comparison of Ca2+-related proteins and nitric oxide synthases between achalasia and control groups by real-time reverse transcription polymerase chain reaction (*P < 0.05). Relative mRNA expression of inducible nitric oxide synthase, neuronal nitric oxide synthase, Cav1.3, IP3R1, and IP3R2 in achalasia was increased compared with controls. (c) The linear correlation between esophageal-integrated relaxation pressure and corresponding mRNA in achalasia patients (*P < 0.05). mRNA of inducible nitric oxide synthase and Cav1.3 correlated with integrated relaxation pressure positively, but there were no linear relations for other parameters (P > 0.05). (d) Immunohistochemistry of CD31, CD45, D2-40, and S-100 in the lower esophageal smooth muscles (SP, original magnification ×200) (AC: Achalasia circular muscle; EC: Esophageal circular muscle in control group; Bar = 100 μm). (e) Immunohistochemistry in achalasia and controls (SP, original magnification ×200) (AC: Achalasia circular muscle, EC: Esophageal circular muscle in control group; Bar = 100 μm).

Click here to view


Because of nonnormal distribution data for each mRNA, Spearman's correlation coefficients were calculated to detect the linear correlation between esophageal IRP and the corresponding mRNA in achalasia patients. mRNA of iNOS and Cav1.3 was correlated with IRP positively (P = 0.008 and 0.036, respectively) and rs was 0.344 and 0.261, respectively, but no linear relations for other parameters (P > 0.05) [Figure 1]c.

In [Figure 1]d, specific indicators showed the different expression, respectively. CD31 was strongly stained in endothelial cells of blood capillaries, with no significant difference between the two groups. CD45 was positive in lymphocytes and leukocytes, D2-40 was strong in lymphatic endothelial cells, and S-100 showed strong staining in nervous tissues and cytoplasm of SMCs in the two groups. However, positive cells of CD45, D2-40, and S-100 in achalasia were less than that in controls. With these auxiliary diagnosis, expression of parameters of this study was easy to be defined in esophageal smooth muscles. Expression of iNOS was negative, but nNOS, Cav1.2, Cav1.3, IP3R1, IP3R2, IP3R3, and RyR2 could be detected positively in IHC in both achalasia and control groups [Figure 1]e. nNOS was distributed in nervous tissues of smooth muscles with strong staining in both groups, but in controls, it was also widely distributed in cytoplasm of SMCs. Cav1.2 and Cav1.3 were distributed on cellular membrane and cytoplasm as IP3R1, IP3R2, IP3R3, and RyR2 in both groups, but positive staining of Cav1.2, IP3R1, IP3R2, and RyR2 were not uniform in achalasia. SMCs of small vessel wall in both groups could be stained positively by Cav1.2 and Cav1.3.

In terms of protein and mRNA expression, IP3R2 was greater in the achalasia group compared with the controls (P = 0.042), but there was no significant difference among the other parameters, which was not consistent with their respective mRNA expression [Table 1].
Table 1: Statistical data in IHC

Click here to view


Most classic studies of achalasia etiology focused on the effects of neurotransmitters such as NO or VIP.[4] NOS is the key rate-limiting enzyme to induce NO in vivo. Its isoenzymes include nNOS, epidermal NOS (eNOS), and iNOS.[4],[8]

In achalasia patients, studies suggested that loss of NO-secreting esophageal myenteric plexus neurons caused imbalance of excitatory and inhibitory neurons, leading to altered manometry results.[4] We detected iNOS and nNOS mRNA in both achalasia and control tissues as positive, but only nNOS was positive in IHC. nNOS staining was almost pale in cytoplasm of SMCs in achalasia, different to the widely distribution in controls. This result showed that nNOS still existed in the smooth muscles of patients' lower esophagus, but the decreased distribution of the nervous tissues accompanied the decreased nNOS expression in the SMCs reduced the effective regulation of the SMCs in the NOS-NO conduction pathway to NO-induced relaxation.

In the achalasia group, there was a positive linear correlation between esophageal IRP and iNOS mRNA (P < 0.05) [Figure 1]c. There are few literatures about the effect of iNOS on the function of esophageal smooth muscles, but iNOS often appears in the pathological conditions though the damage to cells.[10] With the increased iNOS mRNA in achalasia patients, the role of NO in the regulation of esophageal motility and its mechanism of damage to SMCs remained to be studied. Furthermore, we did not detected the same or similar phenomenon that myenteric neurons were replaced by collagen and inflammatory cells as described,[11],[12] because inflammatory cells as lymphocytes and leukocytes stained by CD45 were not gathered or common in the lower esophageal smooth muscles in both achalasia and control groups [Figure 1]d. We might conclude that the dysfunction of lower esophageal relaxation with achalasia not only caused by local neuropathological changes but also associated with local pathological manifestations, such as congenital (primary) or acquired (secondary) lesions, should be considered.

Ca2+-related signal molecules have been most closely studied in the cardiovascular system. There are few studies regarding Ca2+ and Ca2+-related receptors in the esophagus of achalasia patients.[13] In physiological conditions, extracellular Ca2+ enters cells via membrane channels including LTCC to activate IP3 Rs and RyRs through serial signal transduction. LTCC was characterized according to their α1 subunits (160–240 kDa) as Cav1.2 (α1C), Cav1.3 (α1D), and Cav1.1 (α1S).[6],[14] Kovac et al.[6] studied α1C expression in human LES by RT-PCR; their study showed that LTCC participated in the regulation of esophageal tone. RyRs and IP3 Rs are primarily distributed in organelle membrane to regulate [Ca2+]i in cellular activities.[15] RyRs is one of the largest known ion channels, with each subunit about 560 kDa.[15] Similar to RyRs, IP3 Rs is a homotetramer-binded IP3 and Ca2+ channel, and each subunit is about 240–300 kDa.[16]

Expression of LTCC, RyRs, and IP3 Rs subtypes in the same tissue might occur in various combinations.[15],[17],[18] We measured mRNA and protein expression of Cav1.2, Cav1.3, IP3R1, IP3R2, IP3R3, and RyR2 in lower esophageal smooth muscles [Figure 1]a and [Figure 1]e. Compared with controls, mRNA expression of Cav1.3, IP3R1, and IP3R2 was greater [Figure 1]b in achalasia, but only IP3R2 in IHC was greater than that of the controls. We showed that there was positive correlation between esophageal IRP and Cav1.3 mRNA expression [Figure 1]c. This suggests that Ca2+-related proteins involved in the regulation of IRP in achalasia patients. Ca2+ regulation as a myogenic factor appeared to be important in the pathogenesis of achalasia.

In this study, mRNA of nNOS, Cav1.3, and IP3R1 was greater in the achalasia group without statistical difference in corresponding IHC. This might be related to the small samples in both groups. Statistical samples of achalasia were difficult to calculate because the corresponding epidemiological data in China were not available, while the achalasia incidence was 1.6/100,000 in North America.[19] In the future, we will expand our samples to define the possible differences of nNOS, Cav1.3, IP3R1, and other lesions in achalasia patients.

In conclusion, we should focus on Ca2+ regulation as myogenic factors and NOSs in pathogenesis of achalasia. These mechanisms and how they relate to Auerbach's plexus lesions require further studies.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Boland K, Abdul-Hussein M, Tutuian R, Castell DO. Characteristics of consecutive esophageal motility diagnoses after a decade of change. J Clin Gastroenterol 2016;50:301-6. doi: 10.1097/MCG.0000000000000402.  Back to cited text no. 1
    
2.
Ghoshal UC, Daschakraborty SB, Singh R. Pathogenesis of achalasia cardia. World J Gastroenterol 2012;18:3050-7. doi: 10.3748/wjg.v18.i24.3050.  Back to cited text no. 2
    
3.
Liu JF, Sun J, Drew PA. Characterization of excitatory and inhibitory motor neurons to the human gastric clasp and sling fibers. Can J Physiol Pharmacol 2011;89:617-22. doi: 10.1139/Y11-059.  Back to cited text no. 3
    
4.
Holloway RH, Dodds WJ, Helm JF, Hogan WJ, Dent J, Arndorfer RC. Integrity of cholinergic innervation to the lower esophageal sphincter in achalasia. Gastroenterology 1986;90:924-9. doi: 10.1016/0016-5085(86)90869-3.  Back to cited text no. 4
    
5.
Zhang L, Zhao W, Zheng Z, Wang T, Zhao C, Zhou G, et al. Hydrogen sulfide synthesis enzymes reduced in lower esophageal sphincter of patients with achalasia. Dis Esophagus 2016;29:801-6. doi: 10.1111/dote.12385.  Back to cited text no. 5
    
6.
Kovac JR, Preiksaitis HG, Sims SM. Functional and molecular analysis of L-type calcium channels in human esophagus and lower esophageal sphincter smooth muscle. Am J Physiol Gastrointest Liver Physiol 2005;289:G998-1006. doi: 10.1152/ajpgi.00529.2004.  Back to cited text no. 6
    
7.
Wang J, Shimoda LA, Sylvester JT. Ca2+ responses of pulmonary arterial myocytes to acute hypoxia require release from ryanodine and inositol trisphosphate receptors in sarcoplasmic reticulum. Am J Physiol Lung Cell Mol Physiol 2012;303:L161-8. doi: 10.1152/ajplung.00348.2011.  Back to cited text no. 7
    
8.
Squecco R, Garella R, Idrizaj E, Nistri S, Francini F, Baccari MC. Relaxin affects smooth muscle biophysical properties and mechanical activity of the female mouse colon. Endocrinology 2015;156:4398-410. doi: 10.1210/en.2015-1428.  Back to cited text no. 8
    
9.
Soslow RA, Dannenberg AJ, Rush D, Woerner BM, Khan KN, Masferrer J, et al. COX-2 is expressed in human pulmonary, colonic, and mammary tumors. Cancer 2000;89:2637-45. doi: 10.1002/1097-0142(20001215)89:12<2637::AID-CNCR17>3.0.CO;2-B.  Back to cited text no. 9
    
10.
Ming-Fang L, Zai-Ping J, Xin Z, Su-Zhen Z. Inducible nitric oxide synthase and nitric oxide in smooth muscle cells of human abdominal aortic aneurysm (in Chinese). Chin J Gen Surg 2004;19:558-60. doi: 10.3760/j.issn:1007-631X.2004.09.017.  Back to cited text no. 10
    
11.
Goldblum JR, Rice TW, Richter JE. Histopathologic features in esophagomyotomy specimens from patients with achalasia. Gastroenterology 1996;111:648-54. doi: 10.1053/gast.1996.v111.pm8780569.  Back to cited text no. 11
    
12.
Verne GN, Sallustio JE, Eaker EY. Anti-myenteric neuronal antibodies in patients with achalasia. A prospective study. Dig Dis Sci 1997;42:307-13. doi: 10.1016/0016-5085(95)27131-7.  Back to cited text no. 12
    
13.
Fischer H, Fischer J, Boknik P, Gergs U, Schmitz W, Domschke W, et al. Reduced expression of Ca2+-regulating proteins in the upper gastrointestinal tract of patients with achalasia. World J Gastroenterol 2006;12:6002-7. doi: 10.3748/wjg.v12.i37.6002.  Back to cited text no. 13
    
14.
Hashitani H, Lang RJ. Spontaneous activity in the microvasculature of visceral organs: Role of pericytes and voltage-dependent Ca(2+) channels. J Physiol 2016;594:555-65. doi: 10.1113/JP271438.  Back to cited text no. 14
    
15.
Viero C, Thomas NL, Euden J, Mason SA, George CH, Williams AJ. Techniques and methodologies to study the ryanodine receptor at the molecular, subcellular and cellular level. Adv Exp Med Biol 2012;740:183-215. doi: 10.1007/978-94-007-2888-2_8.  Back to cited text no. 15
    
16.
Monkawa T, Miyawaki A, Sugiyama T, Yoneshima H, Yamamoto-Hino M, Furuichi T, et al. Heterotetrameric complex formation of inositol 1,4,5-trisphosphate receptor subunits. J Biol Chem 1995;270:14700-4. doi: 10.1074/jbc.270.24.14700.  Back to cited text no. 16
    
17.
Schierberl K, Hao J, Tropea TF, Ra S, Giordano TP, Xu Q, et al. Cav1.2 L-type Ca2+ channels mediate cocaine-induced GluA1 trafficking in the nucleus accumbens, a long-term adaptation dependent on ventral tegmental area Ca(v)1.3 channels. J Neurosci 2011;31:13562-75. doi: 10.1523/JNEUROSCI.2315-11.2011.  Back to cited text no. 17
    
18.
Fujino I, Yamada N, Miyawaki A, Hasegawa M, Furuichi T, Mikoshiba K. Differential expression of type 2 and type 3 inositol 1,4,5-trisphosphate receptor mRNAs in various mouse tissues: In situ hybridization study. Cell Tissue Res 1995;280:201-10. doi: 10.1007/BF00307790.  Back to cited text no. 18
    
19.
Sadowski DC, Ackah F, Jiang B, Svenson LW. Achalasia: Incidence, prevalence and survival. A population-based study. Neurogastroenterol Motil 2010;22:e256-61. doi: 10.1111/j.1365-2982.2010.01511.x.  Back to cited text no. 19
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed63    
    Printed0    
    Emailed0    
    PDF Downloaded11    
    Comments [Add]    

Recommend this journal




京ICP备05052599号