|
Neutrophils play an important role host defense system against infection. The neutrophils granules fall into peroxidase-positive granules defined by their contents of myeloperoxidase(MPO) and peroxidase-positive granules which may be further subdivided into specific granules and gelatinase granules.The membranes of specific and gelatinase granules relate to phagocytosis and intracellular killing.
Interleukin-8(IL-8) belongs to a member of CXC chemokines produced mainly by monocyte/macrophage.[1] Neutrophils, when appropriately stimulated, can also express and secrete IL-8.[2] IL-8 diaplays a wide range of biologic effects, including chemotaxis and activation of neutrophils.
Several observations[3-5]have proven that end-stage renal disease, especially treated by hemodialysis(HD),presents an increasing dysfunction of phagocytes in phagocytosis and intracellular killing when challenged with bacteria. To investigate the relatonship between uremia and immunity, we study the gene expressions of gp-91phoxand IL-8 on peripheral blood neutrophils by reversal transcription polymerase chain reaction(RT/PCR) in controls and in HD patients, and the function of neutrophils.
METHODS
Cell preparation and stimulus
Peripheral blood neutrophils were isolated from the HD patients and normal healthy donors by Percoll (Pharmacia, Uppsala, Sweden).[6] Briefly, whole blood was fractionated by Ficoll-Hypaque gradient centrifugation(1800 r/m for 20 minutes). Neutrophils were collected and washed twice in phosphate buffer solution (PBS) at 2000 r/m, and resuspended in isoosmotic (285 m Osm) solution, and then layered on the top of 62%. Percoll solution (285 m Osm). Tubes were spun at 1840 r/m for 30 minutes at room teperature. Neutrophils were collected at the interface, washed in PBS and resuspended at 2.5×106/ml in culture medium. Neutropils (purity ≥95%) were assessed by morphologic examination and eaterase staining. Cell culture medium contained RPMI 1640, 50 μg/ml penicillin/streptomycin and 5 mmol/L Hepes supplemented with 10% heat-inactivated fetal calf serum (FCS,Gibco) at 37℃ in 5% CO[2] and at 95% air atmosphere. Escherichia coli O55-B[5] LPS ( Sigma) were diluted into 1 μg/ml just before use.
Cell RNA extration and RT/PCR
Total RNA was extrated from the cells according to the Tri-zol Reagent Pretocol (Gibco). RT/PCR was conducted as follows: One μg RNA from untreated or LPS-treated neutrophils was reversely transcribed with reversal transcriptase buffer with 1 mmol/L deoxynucleotide triphosphate, 20 U Rnase inhibitor, 2.5 U/μl moloney murine leukemia virus transcriptase (Gibco) and 0.1 mol/L DTT. Samples were incubated for 10 minutes at 25℃ , then 1 hour at 37℃, thereafter at 95℃ for 5 minutes. Ten μl of the single-stranded cDNA was incubated on ice with a specific pair of primers designed to amplity cDNA coding for gp-91phox(sense 5' ATGCTGATTCTCTTGCCAGTC 3', antisense 5'CTTGGTGATGACCACCTTCTG 3')[7] and IL-8 (sense 5' ATGACTTCCAAGCTGGCCGTGGC 3', antisense 5'TCTCAGCCCTCTTCAAAAACTTCTC 3'),[8] and as an internal control, human β-actin (sense 5'ATCTGGCACCACCTTCTACAATGAGCTACG 3', antisense 5'CGTCATACTCCTGCTTGCTGATCCACATCTGC 3'). Amplification was undergone in 2.5 mmol/L Mgcl[2],0.2 mol/L dNTP, 2 U/μl Taq DNA polymerase, and in an automated thermal cycler(Perkin-Elmer 9600 USA) at 94℃ for 30 seconds, at 60℃(IL-8), 63℃(gp-91phoxand β-actin) for 45 seconds and at 72℃ for 1 minute. Amplification was stopped at 30 (IL-8), 35 (gp-91phoxand β-actin) cycles. Amplified products were through a 2% ethidium bromide-stained agarose gel along with molecular weight standards. The expected sizes of amplification were 705 bp for gp-91phox, 289 bp for IL-8, and 834 bp for β-actin. The band intensities were estimated from the photo using video-densitometer.
Phogocytosis and imtracellular killing assays
Bacteria
Staphylococcus aureus(S. aureus) provieded by Department of Microbiology of Huashan hospital, Shanghai Medical University were cultured at 37℃ overnight in nutrient broth, harvested by centrifugation at 2300 r/m for 10 minutes washed once in PBS and suspended in hanks balanced salt solution(HBSS), then the concentration of approximately 107 bacteria/ml was regulated by colonies counts.[9]
Bacteria were pre-opsonized by incubating 107S. aureus/ml with 10% AB serum at 37℃ for 25 minutes under slow rotation (4 r/m), them suspension was washed with cold-HBSS, and regulated to a concentratiom of 5×106/ml.
Phagocytosis
Phagocytosis of S. aureusby grannulocytes was measured as the decrease in the number of viable extracellular bacteria. During incubation of 2.5×106 granulocytes/ml together with 5×106 S. aureus/ml and 10% serum at 37℃ under slow rotation (4 r/m), aliquots were taken at different times (0, 60 and 120 minutes) and the number of viable extracellular bacteria was determined by colony counts in the supernatant afer centrifugation of cells and bacteria at 180 r/m for 6 minutes. Serial 10[4]-fold dilution in saline were made . Aliquots of 0.1 ml of each dilutiom were pipetted into nutrient agar plates that were incubated at 37℃ for 24 hours.
Bactericidal assay
Intracellular killing of S. aureus was determined as a decrease in the number of viable intracellular bacteria after a short ingestion period. Briefly, pre-opsonized bacteria and guanulocytes were incubated at 37℃ for 3 minutes under slow rotation, and after that, phagocytosis was stopped by shaking the tubes in crushed ice for 1 minute. The non-ingested bacteria were removed by different centrifugation (180 r/m for 6 minutes), washed twice with ice-cold HBSS, then neutrophils resuspended and incubated at 37℃ under slow rotation (4 r/m). Samples were taken at 0, 60 and 120 minutes. Granulocytes were lysed by adding distilled water and pipetting the suspension for 1 minute. The number of viable intracelluar bacteria was determined by colony counts.
Statistics
Results of phagocytosis and bactericidal assay expressed as mean ±s. Comparation was made by student's t test, and P value less than 0.05 can be considered to be significant statistically.
RESULTS
Impaired expression of gp-91phoxgene, spontaneous expression of IL-8 on untreated neutrophils in HD patients
Figure 1 shows that freshly isolated neutrophils express gp-91phoxmRNA ( n=4, lane 4) in controls, however no gp-91phoxmRNA can be detected in HD patients (lane3). On the contrary, the untreated meutrophils in controls can not express IL-8 mRNA (n=3, lane 6) while in HD patients IL-8 can be spontaneously expressed (n=4, lane 7).
We also investigated the gene expression of IL-8 in peritoneal dialysis and uremia nondialysis patients and the results were negative.
Effects of LPS on gp-91phoxand IL-8 expression in HD patients
Neutrophils gp-91phoxmRNA exhibited the decreased expression compared with controls after stimulated with LPS for 4 hours in HD patients (n=4, lane 2); IL-8 mRNA expression (lane 9), however ,was similar to that on the controls (lane 8).
Phagocytosis and intracellular killing
When neutrophils exposed to S. aureus, the capacity of cells on phagocytosis and killing was impaired in HD patients. As most of literature reported, both phagocytosis and bactericidal in HD patients were obviously impaired. Either at 60 minutes or at 120 minutes the decrease of extracellular bacteria and intracellular bacteria was lesser than that of the controls (Fig. 2).
DISCUSSION
Two metabolic pathways are activated during phagocytosis and their measurement may be taken as a reflection of the functional capacity. Pathways contain the metabolism of glucose through the hexosemonophosphate shunt pathway, and another pathway via the nicotinamide adenine dinucletotide phosphate(NADPH) oxidase system, producing reactive oxygen species, including superoxide ions and hydrogen peroxide (H[2]O[2]). Fc receptors of neutrophils was caused by the important in activation. Early studies showed that uremia was caused by the impaired function of the Fc receptors[10] and suppression of glycolytic activity.[3] In this study, we investigate the gene expression of gp-91phoxin peripheral blood neutropils in maintain hemodialysis patients. It is interesting to note that the untreated neutrophils do not express this gene, and a depressed expression when challenged with LPS for 4 hours, which indicates the dysfunction of flavocytochrome b[558]. The result is consistent with depressed phagocytosis and bactericide in our observation.
IL-8 mRNA can be spontaneously expressed in HD patients, indicating neutropils pre-actived in those patients. Our results suggest that "pre-activation" is accompanied by down-regulation of immune system.
Mechanism of neutrophils dysfunction in HD patients remains incompletely clear, which is perhaps related to complement activating.Pierre Neveceral et al[11 ] suggested that the cuprophan membrane could activate complement, resulting in neutrophils pre-activation. Uremic toxin is another contributing factor. In vitro study showed neutrophils suffered from dysfunction when cells were suspended in uremic plasma or ultrafiltrate. Up to date, however, information about possible toxins is scant. Uremia anemia might be another culprit because anemia affects tissue oxygenation and may subsequently have a negative influence on cell metabolism. It has been reported[12]that the treatment with erythropoietin(EPO) could redress the deficient phagoctosis in HD patients. Finally, another factor that may have a suppressive effect on phagocytic function is iron overload,[13]a condition that is frequently encountered in HD patients, over-administration of iron and overtransfusion. EPO's improvement of phagocytosis perhaps is associated with a decrease in body iron stores.
In summary, our studies suggest that there exists a decreased gp-91phoxgene expression in peripheral blood neutrophils in HD patients, indicating the impaired NADPH-oxidase system. The untreated neutrophils in HD patients spontaneously express IL-8, this pre-activation agrees with defect is multifactorial, which may be related to dialysis membrane bioncompatibility, anemia, and uremic toxicity.
REFERENCES
1. Standiford TJ, Strieter RM, Chensue SW, et al. IL-4 inhibits the expression of IL-8 from stimulated human monocytes. J Immunol 1990;145:1435-1439.
2. Bazzoni F, Cassatella MA, Rossi F, et al.Phagocytosing neutrophils produce and release high amounts of the neutrophil-activating peptide 1/interleukin 8. J Exp Med 1991;173:771-774.
3. Raymond V, Severin R, Annemieke D, et al. Phagocytosis in uremic and hemodialysis patients: a prospective and cross sectional study. Kidney Int 1991;39:320-327.
4. Simeon E, William PR. Host defenses and immunologic alterations associated with chronic hemodialysis. Ann Int Med 1980;93:597-613.
5. Raymond V, Severin R. Polymorphonuclear cekk function and infection in dialysis. Kideny Int 1992;38:91-95.
6. Francesco C, Giuseppe P, Antonello, et al. Rapid killing of actinomycin D-treated tumor cells by human mononuclear cells. J Immunnol 1984;132:936-943.
7. Sefymour JK, Slawomir O, van Wesley CV, et al. Effects of r-interferon on human neutrophils: protection from deterioration on storage. Blood 1992;80:225-234.
8. Smita AS, Moralik RT, Geraldine GM, et al. Interleukin-8 response of gastric epithelial cell lines to helicobadter pylori stimulation in vitro. Infect Immun 1995; 63:1681-1687.
9. Làszlò M, Rita K, Judit T, et al.Impaired microbicidal capacity of mononuclear phagocytes from patients with type Ⅰ gaucher disease: partial correction by enzyme replacement therapy. Blood 1995;86:4645-4649.
10. Ruiz P, Gomez F, Schreiber AD. Impaired function of macrophage Fc receptors in renal disease. N Engl J Med 1990;322:717-722.
11. Pierre N, Michele M, Jean PW. Neutrophile behavior during hemodialysis.Role of membrane contact.Trans Am Soc Artif Int Organs 1988;34:564-567.
12. Veys N, Vanholder R, Ringoir S.Correlation of deficient phagocytosis during erythropoietin(EPO) treatment in maintenance hemodialysis patients.Am J Kidney Dis 1992;19:358-363.
13. Flament J, Goldman M, Waterlot Y, et al. Impariment of phagocyte oxidative metabolism in hemodialyzed patients with iron overload. Chin Nephrol 1986;25:227-230.
|
PDF(-)
Rapid Response |